Stem-loop sequence asu-mir-279b

AccessionMI0018576 (change log)
DescriptionAscaris suum miR-279b stem-loop
Gene family MIPF0000184; mir-279
Literature search

1 open access papers mention asu-mir-279b
(4 sentences)

Stem-loop
   auuc    uc      a      ug         g    - aau 
5'     ggcg  acugga cugguu  cagucuagu caug c   a
       ||||  |||||| ||||||  ||||||||| |||| |    
3'     uugc  ugaucu gaccaa  gucagauca guac g   u
   ---c    uu      c      ua         -    u aag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence asu-miR-279b-5p

Accession MIMAT0021513
Previous IDsasu-miR-279b*
Sequence

17 - 

acugguuugcagucuagugcau

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence asu-miR-279b-3p

Accession MIMAT0021514
Previous IDsasu-miR-279b
Sequence

53 - 

ugacuagacugauaaccagcuc

 - 74

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21685128 "Deep small RNA sequencing from the nematode Ascaris reveals conservation, functional diversification, and novel developmental profiles" Wang J, Czech B, Crunk A, Wallace A, Mitreva M, Hannon GJ, Davis RE Genome Res. 21:1462-1477(2011).