Stem-loop sequence asu-mir-279a

AccessionMI0018575 (change log)
DescriptionAscaris suum miR-279a stem-loop
Gene family MIPF0000184; mir-279
Literature search

1 open access papers mention asu-mir-279a
(4 sentences)

Stem-loop
   cauugc         u      c    c    u      cu    
5'       cacauucuu gcuggg augg ucua gucaug  auc 
         ||||||||| |||||| |||| |||| ||||||  || u
3'       gugugggga cgacuc uacc agau caguac  uga 
   ------         u      a    u    -      uu    
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence asu-miR-279a-5p

Accession MIMAT0021511
Previous IDsasu-miR-279a*
Sequence

18 - 

cugggcauggcucuaugucaug

 - 39

Get sequence
Evidence experimental; Illumina [1]

Mature sequence asu-miR-279a-3p

Accession MIMAT0021512
Previous IDsasu-miR-279a
Sequence

53 - 

ugacuagauccauacucagcu

 - 73

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21685128 "Deep small RNA sequencing from the nematode Ascaris reveals conservation, functional diversification, and novel developmental profiles" Wang J, Czech B, Crunk A, Wallace A, Mitreva M, Hannon GJ, Davis RE Genome Res. 21:1462-1477(2011).