Stem-loop sequence asu-mir-250

AccessionMI0018573 (change log)
DescriptionAscaris suum miR-250 stem-loop
Stem-loop
      g c       ug      -ga    u   c  --     
5' gac g aucuaac  gcaguu   cugu gau cg  ucgu 
   ||| | |||||||  ||||||   |||| ||| ||  ||| a
3' uug c uggauug  ugucaa   gaca cua gc  agcu 
      a u       gu      acc    -   a  ua     
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence asu-miR-250-5p

Accession MIMAT0021507
Previous IDsasu-miR-250*
Sequence

12 - 

acuggcaguugacuguugauccg

 - 34

Get sequence
Evidence experimental; Illumina [1]

Mature sequence asu-miR-250-3p

Accession MIMAT0021508
Previous IDsasu-miR-250
Sequence

48 - 

aaucacagccaaacuguugguua

 - 70

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21685128 "Deep small RNA sequencing from the nematode Ascaris reveals conservation, functional diversification, and novel developmental profiles" Wang J, Czech B, Crunk A, Wallace A, Mitreva M, Hannon GJ, Davis RE Genome Res. 21:1462-1477(2011).