Stem-loop sequence asu-mir-124

Accession MI0018567
Description Ascaris suum miR-124 stem-loop
Gene family MIPF0000021; mir-124
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-124_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-124 microRNA precursor is a small non-coding RNA molecule that has been identified in flies (MI0000373), nematode worms (MI0000302), mouse (MI0000150) and human (MI0000443). The mature ~21 nucleotide microRNAs are processed from hairpin precursor sequences by the Dicer enzyme, and in this case originates from the 3' arm. miR-124 has been found to be the most abundant microRNA expressed in neuronal cells. Experiments to alter expression of miR-124 in neural cells did not appear to affect differentiation. However the topic result quite controversial since different reports described also a role for miR-124 during neuronal differentiation.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
--uuu    cac  c       -   a        u aa 
     gcga   gc uucaccg gug cuuuggug g  g
     ||||   || ||||||| ||| |||||||| |   
     cgcu   cg aaguggc cac ggaaucau c  c
guucu    aac  u       g   -        c ga 
Get sequence

Mature sequence asu-miR-124-5p

Accession MIMAT0021495
Previous IDs asu-miR-124*
Sequence

10 - 

cgccuucaccggugacuuuggu

 - 31

Get sequence
Evidence experimental; Solexa [1]

Mature sequence asu-miR-124-3p

Accession MIMAT0021496
Previous IDs asu-miR-124
Sequence

46 - 

uaaggcacgcggugaaugcca

 - 66

Get sequence
Evidence experimental; Solexa [1]

References

1
PMID:21685128 "Deep small RNA sequencing from the nematode Ascaris reveals conservation, functional diversification, and novel developmental profiles" Wang J, Czech B, Crunk A, Wallace A, Mitreva M, Hannon GJ, Davis RE Genome Res. 21:1462-1477(2011).