Stem-loop sequence asu-mir-87a

AccessionMI0018559 (change log)
DescriptionAscaris suum miR-87a stem-loop
Gene family MIPF0000152; mir-87
Literature search

1 open access papers mention asu-mir-87a
(1 sentences)

Stem-loop
   u       uc       c   ag u    acc      ga 
5'  ccgccac  cgccuga acu  g cuca   ucuguu  u
    |||||||  ||||||| |||  | ||||   ||||||   
3'  ggcggug  guggacu uga  c gagu   ggacga  u
   -       uu       c   aa -    ---      gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence asu-miR-87a-5p

Accession MIMAT0021481
Previous IDsasu-miR-87a*
Sequence

10 - 

ccgccugacacuaggucucaaccu

 - 33

Get sequence
Evidence experimental; Illumina [1]

Mature sequence asu-miR-87a-3p

Accession MIMAT0021482
Previous IDsasu-miR-87a
Sequence

50 - 

gugagcaaagucucagguguug

 - 71

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21685128 "Deep small RNA sequencing from the nematode Ascaris reveals conservation, functional diversification, and novel developmental profiles" Wang J, Czech B, Crunk A, Wallace A, Mitreva M, Hannon GJ, Davis RE Genome Res. 21:1462-1477(2011).