Stem-loop sequence asu-mir-84

AccessionMI0018557 (change log)
DescriptionAscaris suum miR-84 stem-loop
Gene family MIPF0000250; mir-84
Stem-loop
   ---     c a            uaaag       u ug 
5'    aaggc g ugagguaguuua     cugcgag g  u
      ||||| | ||||||||||||     ||||||| |   
3'    uuccg c gcucuaucggau     gacgcuu c  u
   uag     a a            -uuua       c uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence asu-miR-84-5p

Accession MIMAT0021477
Previous IDsasu-miR-84
Sequence

9 - 

ugagguaguuuauaaagcugcga

 - 31

Get sequence
Evidence experimental; Illumina [1]

Mature sequence asu-miR-84-3p

Accession MIMAT0021478
Previous IDsasu-miR-84*
Sequence

46 - 

gcagauuuuaggcuaucucgac

 - 67

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21685128 "Deep small RNA sequencing from the nematode Ascaris reveals conservation, functional diversification, and novel developmental profiles" Wang J, Czech B, Crunk A, Wallace A, Mitreva M, Hannon GJ, Davis RE Genome Res. 21:1462-1477(2011).