Stem-loop sequence asu-mir-79

AccessionMI0018554 (change log)
DescriptionAscaris suum miR-79 stem-loop
Gene family MIPF0000014; mir-9
Literature search

1 open access papers mention asu-mir-79
(1 sentences)

Stem-loop
   -    -   ucc       u        g     -  gag 
5'  uugu cuu   cuuuggu aucuggcu uauga gu   c
    |||| |||   ||||||| |||||||| ||||| ||    
3'  aaca gaa   gaaacca uggaucga auacu ca   c
   u    c   -uc       u        a     a  aua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence asu-miR-79-5p

Accession MIMAT0021472
Previous IDsasu-miR-79*
Sequence

12 - 

uuugguuaucuggcuguauga

 - 32

Get sequence
Evidence experimental; Illumina [1]

Mature sequence asu-miR-79-3p

Accession MIMAT0021473
Previous IDsasu-miR-79
Sequence

48 - 

auaaagcuagguuaccaaagcu

 - 69

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21685128 "Deep small RNA sequencing from the nematode Ascaris reveals conservation, functional diversification, and novel developmental profiles" Wang J, Czech B, Crunk A, Wallace A, Mitreva M, Hannon GJ, Davis RE Genome Res. 21:1462-1477(2011).