Stem-loop sequence asu-mir-46

AccessionMI0018546 (change log)
DescriptionAscaris suum miR-46 stem-loop
Gene family MIPF0000087; mir-46
Stem-loop
       a  g  -        -ca     u      c u a 
5' gcag cg cu aagagagc   ucugu gacagu g c a
   |||| || || ||||||||   ||||| |||||| | |  
3' cguc gu ga uucucucg   aggua cuguca c g u
       c  a  c        uug     -      c c u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence asu-miR-46-5p

Accession MIMAT0021457
Previous IDsasu-miR-46*
Sequence

11 - 

aagagagccaucuguugacagu

 - 32

Get sequence
Evidence experimental; Illumina [1]

Mature sequence asu-miR-46-3p

Accession MIMAT0021458
Previous IDsasu-miR-46
Sequence

47 - 

ugucauggaguugcucucuuca

 - 68

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21685128 "Deep small RNA sequencing from the nematode Ascaris reveals conservation, functional diversification, and novel developmental profiles" Wang J, Czech B, Crunk A, Wallace A, Mitreva M, Hannon GJ, Davis RE Genome Res. 21:1462-1477(2011).