Stem-loop sequence asu-mir-44a

AccessionMI0018545 (change log)
DescriptionAscaris suum miR-44a stem-loop
Gene family MIPF0000132; mir-44
Stem-loop
      a   g  a        c    gc       c  uaua 
5' cag cgu aa cuggaugu ucuc  agucaua gg    u
   ||| ||| || |||||||| ||||  ||||||| ||     
3' guc gcg uu gacuuaca agag  ucaguau cu    a
      g   g  c        c    -a       -  ugag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence asu-miR-44a-5p

Accession MIMAT0021455
Previous IDsasu-miR-44a*
Sequence

12 - 

cuggaugucucucgcagucaua

 - 33

Get sequence
Evidence experimental; Illumina [1]

Mature sequence asu-miR-44a-3p

Accession MIMAT0021456
Previous IDsasu-miR-44a
Sequence

51 - 

ugacuagagacacauucagcu

 - 71

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21685128 "Deep small RNA sequencing from the nematode Ascaris reveals conservation, functional diversification, and novel developmental profiles" Wang J, Czech B, Crunk A, Wallace A, Mitreva M, Hannon GJ, Davis RE Genome Res. 21:1462-1477(2011).