Stem-loop sequence asu-mir-43c-2

AccessionMI0018544 (change log)
DescriptionAscaris suum miR-43c-2 stem-loop
Gene family MIPF0001285; mir-43_2
Stem-loop
   ---ac     c c          u    c      cc c 
5'      agcgg g guggcaaaga acug gaugcg  g g
        ||||| | |||||||||| |||| ||||||  | u
3'      ucguu c cacuguuucu ugac cuaugc  c u
   gcauu     u c          -    a      ua a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence asu-miR-43c-2-5p

Accession MIMAT0022671
Previous IDsasu-miR-43c-2*
Sequence

10 - 

cguggcaaagauacugcgaugcg

 - 32

Get sequence
Evidence experimental; Illumina [1]

Mature sequence asu-miR-43c-3p

Accession MIMAT0021454
Previous IDsasu-miR-43c
Sequence

46 - 

uaucacaguucuuugucacccu

 - 67

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21685128 "Deep small RNA sequencing from the nematode Ascaris reveals conservation, functional diversification, and novel developmental profiles" Wang J, Czech B, Crunk A, Wallace A, Mitreva M, Hannon GJ, Davis RE Genome Res. 21:1462-1477(2011).