Stem-loop sequence asu-mir-43c-1

AccessionMI0018543 (change log)
DescriptionAscaris suum miR-43c-1 stem-loop
Gene family MIPF0001285; mir-43_2
Stem-loop
   u    aca    c c          u    c      ucau 
5'  gcgu   gcag g guggcaagga acug gaugcg    g
    ||||   |||| | |||||||||| |||| ||||||    u
3'  cgca   cguu c cacuguuucu ugac cuaugc    u
   a    cua    u c          -    a      uacg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence asu-miR-43c-1-5p

Accession MIMAT0021453
Previous IDsasu-miR-43c-1*
Sequence

15 - 

cguggcaaggauacugcgaugcg

 - 37

Get sequence
Evidence experimental; Illumina [1]

Mature sequence asu-miR-43c-3p

Accession MIMAT0021454
Previous IDsasu-miR-43c
Sequence

51 - 

uaucacaguucuuugucacccu

 - 72

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21685128 "Deep small RNA sequencing from the nematode Ascaris reveals conservation, functional diversification, and novel developmental profiles" Wang J, Czech B, Crunk A, Wallace A, Mitreva M, Hannon GJ, Davis RE Genome Res. 21:1462-1477(2011).