Stem-loop sequence asu-mir-43b

AccessionMI0018542 (change log)
DescriptionAscaris suum miR-43b stem-loop
Gene family MIPF0001285; mir-43_2
Stem-loop
   -----uau     cac          u    c      ccgc 
5'         agcgg   guggcaaagg gcug gaugcg    g
           |||||   |||||||||| |||| ||||||    u
3'         ucguu   cacuguuucu ugac cuaugc    u
   cgcacacu     uuc          -    a      uaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence asu-miR-43b-5p

Accession MIMAT0021451
Previous IDsasu-miR-43b*
Sequence

11 - 

cguggcaaaggugcugcgaugcg

 - 33

Get sequence
Evidence experimental; Illumina [1]

Mature sequence asu-miR-43b-3p

Accession MIMAT0021452
Previous IDsasu-miR-43b
Sequence

47 - 

uaucacaguucuuugucaccuu

 - 68

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21685128 "Deep small RNA sequencing from the nematode Ascaris reveals conservation, functional diversification, and novel developmental profiles" Wang J, Czech B, Crunk A, Wallace A, Mitreva M, Hannon GJ, Davis RE Genome Res. 21:1462-1477(2011).