Stem-loop sequence asu-mir-43a

AccessionMI0018541 (change log)
DescriptionAscaris suum miR-43a stem-loop
Stem-loop
   ------c    c          --    c      c  caaga 
5'        ccgg gauaguaagu  acug gauaug ug     a
          |||| ||||||||||  |||| |||||| ||      
3'        ggcc cugucguuca  ugac cuauac ac     c
   gucgcuu    u          uc    a      -  aaaca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence asu-miR-43a-5p

Accession MIMAT0021449
Previous IDsasu-miR-43a*
Sequence

7 - 

gauaguaaguacugcgauaug

 - 27

Get sequence
Evidence experimental; Illumina [1]

Mature sequence asu-miR-43a-3p

Accession MIMAT0021450
Previous IDsasu-miR-43a
Sequence

47 - 

uaucacagucuacuugcugucuc

 - 69

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21685128 "Deep small RNA sequencing from the nematode Ascaris reveals conservation, functional diversification, and novel developmental profiles" Wang J, Czech B, Crunk A, Wallace A, Mitreva M, Hannon GJ, Davis RE Genome Res. 21:1462-1477(2011).