Stem-loop sequence asu-mir-34

AccessionMI0018535 (change log)
DescriptionAscaris suum miR-34 stem-loop
Gene family MIPF0000039; mir-34
Stem-loop
   ---gc   ua gu      -c        -    u     g     aga 
5'      gga  a  caccgg  uggcagug uggu agcug uuguc   u
        |||  |  ||||||  |||||||| |||| ||||| |||||    
3'      ccu  u  gugguc  gccgucac acua ucggc aacag   g
   gccua   gc ug      cu        c    -     -     agu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence asu-miR-34-5p

Accession MIMAT0021437
Previous IDsasu-miR-34
Sequence

18 - 

uggcagugugguuagcugguugu

 - 40

Get sequence
Evidence experimental; Illumina [1]

Mature sequence asu-miR-34-3p

Accession MIMAT0021438
Previous IDsasu-miR-34*
Sequence

53 - 

aacggcuaucaccacugccgucc

 - 75

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21685128 "Deep small RNA sequencing from the nematode Ascaris reveals conservation, functional diversification, and novel developmental profiles" Wang J, Czech B, Crunk A, Wallace A, Mitreva M, Hannon GJ, Davis RE Genome Res. 21:1462-1477(2011).