Stem-loop sequence asu-mir-43e

AccessionMI0018534 (change log)
DescriptionAscaris suum miR-43e stem-loop
Gene family MIPF0001285; mir-43_2
Stem-loop
   u  ac      c           u    c    ---c   g 
5'  gc  agcacg gguagcagagg gcug gaua    gcu u
    ||  |||||| ||||||||||| |||| ||||    |||  
3'  cg  ucgugc ccaucguuucu ugac cuau    uga g
   a  cu      u           -    a    acua   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence asu-miR-43e-5p

Accession MIMAT0021435
Previous IDsasu-miR-43e*
Sequence

12 - 

cgguagcagaggugcugcgauacg

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence asu-miR-43e-3p

Accession MIMAT0021436
Previous IDsasu-miR-43e
Sequence

49 - 

uaucacaguucuuugcuaccuc

 - 70

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21685128 "Deep small RNA sequencing from the nematode Ascaris reveals conservation, functional diversification, and novel developmental profiles" Wang J, Czech B, Crunk A, Wallace A, Mitreva M, Hannon GJ, Davis RE Genome Res. 21:1462-1477(2011).