Stem-loop sequence asu-mir-43d

AccessionMI0018533 (change log)
DescriptionAscaris suum miR-43d stem-loop
Stem-loop
   ----   a  a   c    u     c      guuu  a 
5'     ggc gu acc gaug ggcug gauacu    gc c
       ||| || ||| |||| ||||| ||||||    || a
3'     ccg ca ugg cuau cugac cuauga    cg u
   uucu   c  c   c    u     a      --gc  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence asu-miR-43d-5p

Accession MIMAT0021433
Previous IDsasu-miR-43d*
Sequence

7 - 

aacccgauguggcugcgauacu

 - 28

Get sequence
Evidence experimental; Illumina [1]

Mature sequence asu-miR-43d-3p

Accession MIMAT0021434
Previous IDsasu-miR-43d
Sequence

46 - 

uaucacagucuuauccgguca

 - 66

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21685128 "Deep small RNA sequencing from the nematode Ascaris reveals conservation, functional diversification, and novel developmental profiles" Wang J, Czech B, Crunk A, Wallace A, Mitreva M, Hannon GJ, Davis RE Genome Res. 21:1462-1477(2011).