Stem-loop sequence asu-mir-9

AccessionMI0018532 (change log)
DescriptionAscaris suum miR-9 stem-loop
Gene family MIPF0000014; mir-9
Stem-loop
   ----  a   u       ua       g     gu  cgc 
5'     gc auu cuuuggu  ucuagcu uauga  ac   g
       || ||| |||||||  ||||||| |||||  ||    
3'     cg uaa gaagcca  aggucga auacu  ug   u
   ucgc  g   u       gc       a     gc  auu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence asu-miR-9-5p

Accession MIMAT0021431
Previous IDsasu-miR-9
Sequence

7 - 

ucuuugguuaucuagcuguauga

 - 29

Get sequence
Evidence experimental; Illumina [1]

Mature sequence asu-miR-9-3p

Accession MIMAT0021432
Previous IDsasu-miR-9*
Sequence

48 - 

auaaagcuggacgaccgaaguaa

 - 70

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21685128 "Deep small RNA sequencing from the nematode Ascaris reveals conservation, functional diversification, and novel developmental profiles" Wang J, Czech B, Crunk A, Wallace A, Mitreva M, Hannon GJ, Davis RE Genome Res. 21:1462-1477(2011).