Stem-loop sequence asu-mir-2a

AccessionMI0018529 (change log)
DescriptionAscaris suum miR-2a stem-loop
Gene family MIPF0000049; mir-2
Literature search

1 open access papers mention asu-mir-2a
(4 sentences)

Stem-loop
   ----  uc             -    g     u  uu  gg 
5'     gu  cagcacgucaaag uggu gugau ug  gu  a
       ||  ||||||||||||| |||| ||||| ||  ||   
3'     cg  gucguguaguuuc accg cacua ac  cg  u
   cuga  gu             g    a     u  -u  aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence asu-miR-2a-5p

Accession MIMAT0021425
Previous IDsasu-miR-2a*
Sequence

10 - 

cgucaaagugguggugauuug

 - 30

Get sequence
Evidence experimental; Illumina [1]

Mature sequence asu-miR-2a-3p

Accession MIMAT0021426
Previous IDsasu-miR-2a
Sequence

46 - 

uaucacagccagcuuugaugugc

 - 68

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21685128 "Deep small RNA sequencing from the nematode Ascaris reveals conservation, functional diversification, and novel developmental profiles" Wang J, Czech B, Crunk A, Wallace A, Mitreva M, Hannon GJ, Davis RE Genome Res. 21:1462-1477(2011).