Stem-loop sequence asu-mir-81b

AccessionMI0018526 (change log)
DescriptionAscaris suum miR-81b stem-loop
Stem-loop
   uu   c    a         -    c ga      u  aa 
5'   guu ucaa acgggugug caug a  ucaugg gu  u
     ||| |||| ||||||||| |||| |  |||||| ||   
3'   cga aguu ugucuacac guac u  aguacu cg  a
   ac   a    c         c    - ag      -  au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence asu-miR-81b-5p

Accession MIMAT0021419
Previous IDsasu-miR-81b*
Sequence

12 - 

acgggugugcaugcagaucaug

 - 33

Get sequence
Evidence experimental; Illumina [1]

Mature sequence asu-miR-81b-3p

Accession MIMAT0021420
Previous IDsasu-miR-81b
Sequence

49 - 

ugagaucaugccacaucugucu

 - 70

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21685128 "Deep small RNA sequencing from the nematode Ascaris reveals conservation, functional diversification, and novel developmental profiles" Wang J, Czech B, Crunk A, Wallace A, Mitreva M, Hannon GJ, Davis RE Genome Res. 21:1462-1477(2011).