Stem-loop sequence osa-MIR5337a

AccessionMI0018519 (change log)
Previous IDsosa-MIR5337
DescriptionOryza sativa miR5337 stem-loop
Literature search

3 open access papers mention osa-MIR5337a
(4 sentences)

Stem-loop
   c  ucau       u    guc                ----   a                            a   cu a          cauc      uuuuuu    gauucacuga 
5'  cu    uucaaau acuu   guucuagcuuuguccu    uaa cauguauaucuuugaccaucaauuuuua aaa  c uaugguuuaa    auauga      uuua          c
    ||    ||||||| ||||   ||||||||||||||||    ||| |||||||||||||||||||||||||||| |||  | ||||||||||    ||||||      ||||           
3'  ga    gaguuua ugaa   caagaucgaaacagga    guu guacauauagaaacugguaguuaaaaau uuu  g auaucaaguu    uauacu      aaau          a
   a  ucau       -    aaa                uuca   c                            c   ag c          ---u      caacau    aauuucauaa 
Get sequence
Deep sequencing
27 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr4: 5621964-5622201 [+]
intergenic
Database links

Mature sequence osa-miR5337a

Accession MIMAT0021410
Previous IDsosa-miR5337
Sequence

11 - 

aaauuacuugucguucuagcu

 - 31

Get sequence
Deep sequencing13 reads, 2 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:21791435 "Differential expression of the microRNAs in superior and inferior spikelets in rice (Oryza sativa)" Peng T, Lv Q, Zhang J, Li J, Du Y, Zhao Q J Exp Bot. 62:4943-4954(2011).