Stem-loop sequence rmi-mir-5336

AccessionMI0018518 (change log)
DescriptionRhipicephalus microplus miR-5336 stem-loop
Literature search

1 open access papers mention rmi-mir-5336
(1 sentences)

Stem-loop
   ------------------------------------uca  ucuuu     --    cg  --   gu u      g a   c  aa 
5'                                        cg     gaucu  cauu  gc  gcg  u ccucga a gca ag  a
                                          ||     |||||  ||||  ||  |||  | |||||| | ||| ||   
3'                                        gc     cuggg  guag  ug  cgc  a ggaguu u cgu uc  g
   acguggugucgccaccggcgugugguacgacaaauacgg  ---uu     ac    au  aa   ug -      g c   -  aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence rmi-miR-5336

Accession MIMAT0021409
Sequence

8 - 

uuugaucucauucggcgcgguuuccuc

 - 34

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21699734 "Evolutionary conserved microRNAs are ubiquitously expressed compared to tick-specific miRNAs in the cattle tick Rhipicephalus (Boophilus) microplus" Barrero RA, Keeble-Gagnere G, Zhang B, Moolhuijzen P, Ikeo K, Tateno Y, Gojobori T, Guerrero FD, Lew-Tabor A, Bellgard M BMC Genomics. 12:328(2011).