Stem-loop sequence rmi-mir-5334

AccessionMI0018516 (change log)
DescriptionRhipicephalus microplus miR-5334 stem-loop
Literature search

1 open access papers mention rmi-mir-5334
(1 sentences)

Stem-loop
   --  ugu     c   ------uu     ug         cucu   gu     -  u  ---c     u 
5'   cu   gaagc uuc        cgguu  gccggcugg    uga  aacca cg cc    cagau c
     ||   ||||| |||        |||||  |||||||||    |||  ||||| || ||    ||||| u
3'   gg   cuucg aag        gucgg  uggcugacc    acu  uuggu gu gg    gucug g
   ug  --u     -   uuguccau     ug         -acc   ac     u  c  uuuc     u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence rmi-miR-5334

Accession MIMAT0021407
Sequence

75 - 

uguugguucaucaccaccagucggugug

 - 102

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21699734 "Evolutionary conserved microRNAs are ubiquitously expressed compared to tick-specific miRNAs in the cattle tick Rhipicephalus (Boophilus) microplus" Barrero RA, Keeble-Gagnere G, Zhang B, Moolhuijzen P, Ikeo K, Tateno Y, Gojobori T, Guerrero FD, Lew-Tabor A, Bellgard M BMC Genomics. 12:328(2011).