Stem-loop sequence rmi-mir-5331

AccessionMI0018513 (change log)
DescriptionRhipicephalus microplus miR-5331 stem-loop
Literature search

1 open access papers mention rmi-mir-5331
(1 sentences)

Stem-loop
   ugcacgcugaagcgugaacgaaguggcguguccaguu         --g   -     ac    -ag  gcug     a   ag   g a 
5'                                      gccugcgcc   guc ccgca  ugug   uc    ggauc gug  gcu c g
                                        |||||||||   ||| |||||  ||||   ||    ||||| |||  ||| | a
3'                                      uggaugcgg   uag ggcgu  guac   ag    ccugg cac  cgg g u
   -------------------------------------         gag   c     ca    gaa  ---a     a   ga   g u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence rmi-miR-5331

Accession MIMAT0021404
Sequence

104 - 

uccagaaagcaugacugcggcgaugag

 - 130

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21699734 "Evolutionary conserved microRNAs are ubiquitously expressed compared to tick-specific miRNAs in the cattle tick Rhipicephalus (Boophilus) microplus" Barrero RA, Keeble-Gagnere G, Zhang B, Moolhuijzen P, Ikeo K, Tateno Y, Gojobori T, Guerrero FD, Lew-Tabor A, Bellgard M BMC Genomics. 12:328(2011).