Stem-loop sequence rmi-mir-5329

AccessionMI0018511 (change log)
DescriptionRhipicephalus microplus miR-5329 stem-loop
Literature search

1 open access papers mention rmi-mir-5329
(1 sentences)

Stem-loop
   ggucgacagaggaga   agaa      g  aga  ca   a   -a    gaacg  -   gaa 
5'                gcg    agcgcg ga   gc  gag cgc  gcga     gc gac   c
                  |||    |||||| ||   ||  ||| |||  ||||     || |||   g
3'                cgu    uugcgu uu   cg  uuc gcg  cguu     cg cug   a
   ---------------   ---g      g  -gg  ag   a   ag    --aag  u   aga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence rmi-miR-5329

Accession MIMAT0021402
Sequence

84 - 

agcgacuugagcgguugugcguugu

 - 108

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21699734 "Evolutionary conserved microRNAs are ubiquitously expressed compared to tick-specific miRNAs in the cattle tick Rhipicephalus (Boophilus) microplus" Barrero RA, Keeble-Gagnere G, Zhang B, Moolhuijzen P, Ikeo K, Tateno Y, Gojobori T, Guerrero FD, Lew-Tabor A, Bellgard M BMC Genomics. 12:328(2011).