Stem-loop sequence rmi-mir-5317a

AccessionMI0018498 (change log)
DescriptionRhipicephalus microplus miR-5317a stem-loop
Literature search

1 open access papers mention rmi-mir-5317a
(1 sentences)

Stem-loop
   ugguaugacaug          a            u                       u 
5'             acgauaguua agcgcgagaaca aacgacgacacagagacaagaag g
               |||||||||| |||||||||||| |||||||||||||||||||||||  
3'             ugcuaucaau ucgcgcucuugu uugcugcugugucucuguucuuu u
   ------------          a            u                       c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence rmi-miR-5317a

Accession MIMAT0021389
Sequence

64 - 

uuucuugucucugugucgucguuu

 - 87

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21699734 "Evolutionary conserved microRNAs are ubiquitously expressed compared to tick-specific miRNAs in the cattle tick Rhipicephalus (Boophilus) microplus" Barrero RA, Keeble-Gagnere G, Zhang B, Moolhuijzen P, Ikeo K, Tateno Y, Gojobori T, Guerrero FD, Lew-Tabor A, Bellgard M BMC Genomics. 12:328(2011).