Stem-loop sequence rmi-mir-5316b

AccessionMI0018497 (change log)
DescriptionRhipicephalus microplus miR-5316b stem-loop
Gene family MIPF0001364; mir-5316
Literature search

1 open access papers mention rmi-mir-5316b
(1 sentences)

Stem-loop
   ----aguuu  u     au c       -      u      au     uugaua 
5'          gg accac  g aggcucg cgaaaa guucug  uggca      g
            || |||||  | ||||||| |||||| ||||||  |||||       
3'          cu uggug  c uucgagc gcuuuu cggggc  acugu      a
   uacgcugcu  u     -c u       a      c      -c     uaaaua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence rmi-miR-5316b

Accession MIMAT0021388
Sequence

61 - 

ucaccggggccuuuucgacgag

 - 82

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21699734 "Evolutionary conserved microRNAs are ubiquitously expressed compared to tick-specific miRNAs in the cattle tick Rhipicephalus (Boophilus) microplus" Barrero RA, Keeble-Gagnere G, Zhang B, Moolhuijzen P, Ikeo K, Tateno Y, Gojobori T, Guerrero FD, Lew-Tabor A, Bellgard M BMC Genomics. 12:328(2011).