Stem-loop sequence isc-mir-5315

AccessionMI0018495 (change log)
DescriptionIxodes scapularis miR-5315 stem-loop
Literature search

1 open access papers mention isc-mir-5315
(1 sentences)

Stem-loop
   -cg  aacu     -gc       aac     a  c  a    c     cg 
5'    gg    cgggu   gagggug   acaac uc gg caag acgug  c
      ||    |||||   |||||||   ||||| || || |||| |||||  g
3'    uc    gccca   cuuccgc   uguug ag cc guuc uguac  u
   gca  gaac     aaa       cuc     a  c  c    u     uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Iscaw1) Overlapping transcripts
DS734036: 1283486-1283588 [+]
intergenic
Database links

Mature sequence isc-miR-5315

Accession MIMAT0021386
Sequence

23 - 

aacacaacauccggacaagcac

 - 44

Get sequence
Evidence not experimental

References

1
PMID:21699734 "Evolutionary conserved microRNAs are ubiquitously expressed compared to tick-specific miRNAs in the cattle tick Rhipicephalus (Boophilus) microplus" Barrero RA, Keeble-Gagnere G, Zhang B, Moolhuijzen P, Ikeo K, Tateno Y, Gojobori T, Guerrero FD, Lew-Tabor A, Bellgard M BMC Genomics. 12:328(2011).