Stem-loop sequence isc-mir-5314

AccessionMI0018494 (change log)
DescriptionIxodes scapularis miR-5314 stem-loop
Literature search

1 open access papers mention isc-mir-5314
(2 sentences)

Stem-loop
   --gaaacaacug      g  uu      a           a     uc  a 
5'             cggcuc gg  caucau aggauaucauc auauu  gc a
               |||||| ||  |||||| ||||||||||| |||||  ||  
3'             guugag cc  guagua uucuguaguag uauaa  cg u
   ccgcacuaacug      g  uc      c           a     -c  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Iscaw1) Overlapping transcripts
DS954809: 999151-999253 [-]
intergenic
Database links

Mature sequence isc-miR-5314

Accession MIMAT0021385
Sequence

59 - 

uauagaugaugucuucaugaugc

 - 81

Get sequence
Evidence not experimental

References

1
PMID:21699734 "Evolutionary conserved microRNAs are ubiquitously expressed compared to tick-specific miRNAs in the cattle tick Rhipicephalus (Boophilus) microplus" Barrero RA, Keeble-Gagnere G, Zhang B, Moolhuijzen P, Ikeo K, Tateno Y, Gojobori T, Guerrero FD, Lew-Tabor A, Bellgard M BMC Genomics. 12:328(2011).