Stem-loop sequence isc-mir-5312

AccessionMI0018492 (change log)
DescriptionIxodes scapularis miR-5312 stem-loop
Literature search

1 open access papers mention isc-mir-5312
(1 sentences)

Stem-loop
   ---a    a  c       a      ug  u               ug -ga a 
5'     gcag gu auguugc cacaga  gc gaacguuguuaugcg  u   c u
       |||| || ||||||| ||||||  || |||||||||||||||  |   |  
3'     uguu cg uacagcg guguuu  ug cuuguaauaaugcgc  g   g g
   accc    g  u       a      gu  c               gu aaa u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Iscaw1) Overlapping transcripts
DS900645: 19149-19254 [+]
intergenic
Database links

Mature sequence isc-miR-5312

Accession MIMAT0021383
Sequence

24 - 

uggcugaacguuguuaugcgu

 - 44

Get sequence
Evidence not experimental

References

1
PMID:21699734 "Evolutionary conserved microRNAs are ubiquitously expressed compared to tick-specific miRNAs in the cattle tick Rhipicephalus (Boophilus) microplus" Barrero RA, Keeble-Gagnere G, Zhang B, Moolhuijzen P, Ikeo K, Tateno Y, Gojobori T, Guerrero FD, Lew-Tabor A, Bellgard M BMC Genomics. 12:328(2011).