Stem-loop sequence isc-mir-5310

AccessionMI0018490 (change log)
DescriptionIxodes scapularis miR-5310 stem-loop
Literature search

1 open access papers mention isc-mir-5310
(1 sentences)

Stem-loop
   ----   - -  -a   ug     g        -g             g   ----   u 
5'     gaa g gc  ccu  gacga cggcguuu  gucggacuacacc uga    ggg g
       ||| | ||  |||  ||||| ||||||||  ||||||||||||| |||    |||  
3'     cuu c cg  ggg  cuguu gcugcaaa  cggucugaugugg gcu    ucc c
   gcgg   a g  ga   gu     g        ga             a   gagg   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Iscaw1) Overlapping transcripts
DS649088: 485358-485467 [-]
intergenic
Database links

Mature sequence isc-miR-5310

Accession MIMAT0021381
Sequence

65 - 

uguagucuggcagaaacgucg

 - 85

Get sequence
Evidence not experimental

References

1
PMID:21699734 "Evolutionary conserved microRNAs are ubiquitously expressed compared to tick-specific miRNAs in the cattle tick Rhipicephalus (Boophilus) microplus" Barrero RA, Keeble-Gagnere G, Zhang B, Moolhuijzen P, Ikeo K, Tateno Y, Gojobori T, Guerrero FD, Lew-Tabor A, Bellgard M BMC Genomics. 12:328(2011).