Stem-loop sequence isc-mir-3931

AccessionMI0018489 (change log)
DescriptionIxodes scapularis miR-3931 stem-loop
Gene family MIPF0001585; mir-3931
Literature search

1 open access papers mention isc-mir-3931
(2 sentences)

Stem-loop
   ----ucgaagac    cacu   uac               uu  c   g   u 
5'             ugca    gga   gauuuguaccgacuc  gg uag uuu c
               ||||    |||   |||||||||||||||  || ||| |||  
3'             acgu    ccu   cuaagcauggcugag  uc auc aag g
   ggcaccucaaau    cucu   uuc               uu  -   a   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Iscaw1) Overlapping transcripts
DS763086: 296440-296544 [-]
intergenic
Database links

Mature sequence isc-miR-3931

Accession MIMAT0021380
Sequence

59 - 

uacuuugagucgguacgaauccu

 - 81

Get sequence
Evidence not experimental

References

1
PMID:21699734 "Evolutionary conserved microRNAs are ubiquitously expressed compared to tick-specific miRNAs in the cattle tick Rhipicephalus (Boophilus) microplus" Barrero RA, Keeble-Gagnere G, Zhang B, Moolhuijzen P, Ikeo K, Tateno Y, Gojobori T, Guerrero FD, Lew-Tabor A, Bellgard M BMC Genomics. 12:328(2011).