Stem-loop sequence isc-mir-5309

AccessionMI0018488 (change log)
DescriptionIxodes scapularis miR-5309 stem-loop
Literature search

1 open access papers mention isc-mir-5309
(1 sentences)

Stem-loop
   ---ga  a   aa  -gc      -   c a        c  c    cc   ucua    c 
5'      ga gga  gc   ccggag uuc g gguuucca gg gcau  gcc    ggcu g
        || |||  ||   |||||| ||| | |||||||| || ||||  |||    ||||  
3'      cu ccu  cg   ggccuc aag c ccaaaggu cc cgua  cgg    ccga g
   ggcaa  a   --  auu      u   c -        a  -    -a   ----    c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Iscaw1) Overlapping transcripts
DS745599: 24786-24895 [-]
intergenic
Database links

Mature sequence isc-miR-5309

Accession MIMAT0021379
Sequence

66 - 

caaugcccauggaaaccccgaa

 - 87

Get sequence
Evidence not experimental

References

1
PMID:21699734 "Evolutionary conserved microRNAs are ubiquitously expressed compared to tick-specific miRNAs in the cattle tick Rhipicephalus (Boophilus) microplus" Barrero RA, Keeble-Gagnere G, Zhang B, Moolhuijzen P, Ikeo K, Tateno Y, Gojobori T, Guerrero FD, Lew-Tabor A, Bellgard M BMC Genomics. 12:328(2011).