Stem-loop sequence isc-mir-5308

AccessionMI0018487 (change log)
DescriptionIxodes scapularis miR-5308 stem-loop
Literature search

1 open access papers mention isc-mir-5308
(4 sentences)

Stem-loop
   --cuacgcaauugcacc           u     g    g   a     agcu 
5'                  aaaacccucuc gugcu ugga gua uauau    g
                    ||||||||||| ||||| |||| ||| |||||     
3'                  uuuugggggag cacga accu cau auaua    u
   gagcuacuacucacuca           u     a    g   -     caac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Iscaw1) Overlapping transcripts
DS911923: 134615-134719 [-]
intergenic
Database links

Mature sequence isc-miR-5308

Accession MIMAT0021378
Sequence

25 - 

ucugugcuguggagguaauauau

 - 47

Get sequence
Evidence not experimental

References

1
PMID:21699734 "Evolutionary conserved microRNAs are ubiquitously expressed compared to tick-specific miRNAs in the cattle tick Rhipicephalus (Boophilus) microplus" Barrero RA, Keeble-Gagnere G, Zhang B, Moolhuijzen P, Ikeo K, Tateno Y, Gojobori T, Guerrero FD, Lew-Tabor A, Bellgard M BMC Genomics. 12:328(2011).