Stem-loop sequence isc-mir-5307

AccessionMI0018486 (change log)
DescriptionIxodes scapularis miR-5307 stem-loop
Literature search

1 open access papers mention isc-mir-5307
(2 sentences)

Stem-loop
   -----    --cu  c  c    g       a               u     g gcu 
5'      ugca    gg gc uucc gaggccu aucucauuugguauc cuggg g   g
        ||||    || || |||| ||||||| ||||||||||||||| ||||| |   a
3'      acgu    cc cg aggg cucuggg uagaguagaccaugg gaccu c   g
   gcagu    accu  a  -    g       g               -     g agc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Iscaw1) Overlapping transcripts
DS942119: 46308-46417 [-]
intergenic
Clustered miRNAs
< 10kb from isc-mir-5307
isc-mir-5307DS942119: 46308-46417 [-]
isc-mir-12DS942119: 45739-45839 [-]
Database links

Mature sequence isc-miR-5307

Accession MIMAT0021377
Sequence

24 - 

uaaucucauuugguaucucuggg

 - 46

Get sequence
Evidence not experimental

References

1
PMID:21699734 "Evolutionary conserved microRNAs are ubiquitously expressed compared to tick-specific miRNAs in the cattle tick Rhipicephalus (Boophilus) microplus" Barrero RA, Keeble-Gagnere G, Zhang B, Moolhuijzen P, Ikeo K, Tateno Y, Gojobori T, Guerrero FD, Lew-Tabor A, Bellgard M BMC Genomics. 12:328(2011).