Stem-loop sequence isc-mir-5306

AccessionMI0018485 (change log)
DescriptionIxodes scapularis miR-5306 stem-loop
Literature search

1 open access papers mention isc-mir-5306
(1 sentences)

Stem-loop
   gccggauuacca       u          ac      u   aa     uaggg 
5'             gcuugcc ggggaggagc  cgcgug uac  cuucg     a
               ||||||| ||||||||||  |||||| |||  |||||     g
3'             ugaacgg uccuuccucg  gugcac aug  gaggc     a
   ccgcugcgacgg       c          ca      u   -a     cggua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Iscaw1) Overlapping transcripts
DS717196: 247001-247110 [+]
intergenic
Database links

Mature sequence isc-miR-5306

Accession MIMAT0021376
Sequence

66 - 

agaguaucacgugacgcuccuu

 - 87

Get sequence
Evidence not experimental

References

1
PMID:21699734 "Evolutionary conserved microRNAs are ubiquitously expressed compared to tick-specific miRNAs in the cattle tick Rhipicephalus (Boophilus) microplus" Barrero RA, Keeble-Gagnere G, Zhang B, Moolhuijzen P, Ikeo K, Tateno Y, Gojobori T, Guerrero FD, Lew-Tabor A, Bellgard M BMC Genomics. 12:328(2011).