Stem-loop sequence isc-mir-5305

AccessionMI0018484 (change log)
DescriptionIxodes scapularis miR-5305 stem-loop
Stem-loop
      - c  -gc         ac             c          gguaau 
5' acg g gg   auuuggcgg  ucuaaguuaaucu caagcccaau      u
   ||| | ||   |||||||||  ||||||||||||| ||||||||||       
3' ugc c cu   uaaaccgcc  agauucgauuaga guucggguua      c
      a a  aca         cc             a          acugcu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Iscaw1) Overlapping transcripts
DS696092: 157384-157487 [+]
intergenic
Database links

Mature sequence isc-miR-5305

Accession MIMAT0021375
Sequence

60 - 

uugggcuugaagauuagcuuag

 - 81

Get sequence
Evidence not experimental

References

1
PMID:21699734 "Evolutionary conserved microRNAs are ubiquitously expressed compared to tick-specific miRNAs in the cattle tick Rhipicephalus (Boophilus) microplus" Barrero RA, Keeble-Gagnere G, Zhang B, Moolhuijzen P, Ikeo K, Tateno Y, Gojobori T, Guerrero FD, Lew-Tabor A, Bellgard M BMC Genomics. 12:328(2011).