Stem-loop sequence sly-MIR482a

AccessionMI0018482 (change log)
Previous IDssly-MIR482
DescriptionSolanum lycopersicum miR482a stem-loop
Gene family MIPF0000403; MIR482
Literature search

22 open access papers mention sly-MIR482a
(255 sentences)

Stem-loop
         u          u    -            uu  uuuuuc 
5' cgaaaa cuauggggau ggug aguuggaaagcu  uc      u
   |||||| |||||||||| |||| ||||||||||||  ||      u
3' gcuuuu gguauccuua ccac uuaaccuuucga  ag      c
         u          c    c            uu  uguucu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SL2.50; GCA_000188115.2) Overlapping transcripts
chr3: 64766256-64766347 [+]
intergenic
Database links

Mature sequence sly-miR482a

Accession MIMAT0020769
Previous IDssly-miR482
Sequence

61 - 

uuuccaauuccacccauuccua

 - 82

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21443685 "Profiling of short RNAs during fleshy fruit development reveals stage-specific sRNAome expression patterns" Mohorianu I, Schwach F, Jing R, Lopez-Gomollon S, Moxon S, Szittya G, Sorefan K, Moulton V, Dalmay T Plant J. 67:232-246(2011).
2
PMID:22307647 "MicroRNA regulation of plant innate immune receptors" Li F, Pignatta D, Bendix C, Brunkard JO, Cohn MM, Tung J, Sun H, Kumar P, Baker B Proc Natl Acad Sci U S A. 109:1790-1795(2012).