Stem-loop sequence sly-MIR482e

AccessionMI0018478 (change log)
Previous IDssly-MIR5301
DescriptionSolanum lycopersicum miR482e stem-loop
Gene family MIPF0000403; MIR482
Literature search

21 open access papers mention sly-MIR482e
(265 sentences)

Stem-loop
     u  gu  uau   aauauu       ----uu        u  g   auug      ug u   u     u     -             aaa   aau 
5' ga cu  gc   gga      gauggcg      gaaaggga ga agu    ggaagu  u ggu guggg ggggu ggaaagauuugau   ucu   u
   || ||  ||   |||      |||||||      |||||||| || |||    ||||||  | ||| ||||| ||||| |||||||||||||   |||    
3' cu ga  cg   ccu      cuacugu      cuuucccu cu ucg    ccuuca  a cca uaccc ccuca ccuuucuaaauua   aga   u
     u  au  uuu   ------       uuacuu        -  -   auca      gu c   -     u     u             --g   aau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SL2.50; GCA_000188115.2) Overlapping transcripts
chr4: 56023736-56023923 [+]
intergenic
Database links

Mature sequence sly-miR482e-5p

Accession MIMAT0020765
Previous IDssly-miR5301
Sequence

63 - 

ugugggugggguggaaagauu

 - 83

Get sequence
Evidence experimental; Illumina [1-2]

Mature sequence sly-miR482e-3p

Accession MIMAT0032124
Sequence

112 - 

ucuuuccuacuccucccauacc

 - 133

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:21443685 "Profiling of short RNAs during fleshy fruit development reveals stage-specific sRNAome expression patterns" Mohorianu I, Schwach F, Jing R, Lopez-Gomollon S, Moxon S, Szittya G, Sorefan K, Moulton V, Dalmay T Plant J. 67:232-246(2011).
2
PMID:24376253 "Global and local perturbation of the tomato microRNA pathway by a trans-activated DICER-LIKE 1 mutant" Kravchik M, Sunkar R, Damodharan S, Stav R, Zohar M, Isaacson T, Arazi T J Exp Bot. 65:725-739(2014).