Stem-loop sequence mtr-MIR5287b

AccessionMI0018451 (change log)
DescriptionMedicago truncatula miR5287b stem-loop
Gene family MIPF0000875; MIR2593
Literature search

1 open access papers mention mtr-MIR5287b
(1 sentences)

Stem-loop
   aag                            g    a    c        a                      a    au 
5'    gacuauauccuccggucacuauuauaag aaaa uuaa auuuuaga ucauucguuaaaugauguaugu gucu  a
      |||||||||||||||||||||||||||| |||| |||| |||||||| |||||||||||||||||||||| ||||  a
3'    uugaugugggaggcuagugauaauauuc uuuu aauu uaaaaucu aguaaguaauuuacuacauaca caga  u
   uga                            g    c    a        a                      c    aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr6: 20018282-20018444 [+]
intergenic
Database links

Mature sequence mtr-miR5287b

Accession MIMAT0021348
Sequence

131 - 

ugcuuauaauagugaucggagggu

 - 154

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21571671 "Stars and symbiosis: microRNA- and microRNA*-mediated transcript cleavage involved in arbuscular mycorrhizal symbiosis" Devers EA, Branscheid A, May P, Krajinski F Plant Physiol. 156:1990-2010(2011).