Stem-loop sequence mtr-MIR5287a

AccessionMI0018450 (change log)
DescriptionMedicago truncatula miR5287a stem-loop
Gene family MIPF0000875; MIR2593
Literature search

1 open access papers mention mtr-MIR5287a
(1 sentences)

Stem-loop
   --aaaaauacac      c                    cua            c                      u uuua 
5'             cuuccg ucacuaauauaagcaaaaau   auuuuuuagaua auucaguuaaugauguaugugg c    u
               |||||| ||||||||||||||||||||   |||||||||||| |||||||||||||||||||||| |     
3'             ggaggc agugauuauauucguuuuua   uaaaaaauuuau uaaguuaauuacuacauauauu g    u
   uaacaucaucua      c                    -ua            a                      - uaua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr2: 17475454-17475617 [-]
intergenic
Database links

Mature sequence mtr-miR5287a

Accession MIMAT0021347
Sequence

131 - 

ugcuuauauuagugaccggaggau

 - 154

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21571671 "Stars and symbiosis: microRNA- and microRNA*-mediated transcript cleavage involved in arbuscular mycorrhizal symbiosis" Devers EA, Branscheid A, May P, Krajinski F Plant Physiol. 156:1990-2010(2011).