Stem-loop sequence mtr-MIR2590j

AccessionMI0018437 (change log)
DescriptionMedicago truncatula miR2590j stem-loop
Gene family MIPF0000834; MIR2590
Literature search

1 open access papers mention mtr-MIR2590j
(1 sentences)

Stem-loop
   auc      au                  g          c          ---   agaaa     -----cu    uu     -    caa  aa      ----g   g 
5'    aagaaa  uucaagaaugacauggca aauaaucacc uuagauuuua   uca     uaguc       gaaa  aaugc uagc   ua  aucuca     ucu g
      ||||||  |||||||||||||||||| |||||||||| ||||||||||   |||     |||||       ||||  ||||| ||||   ||  ||||||     |||  
3'    uucuuu  aaguucuuacuguaccgu uuauuagugg aaucuaaagu   agu     auuag       uuuu  uuaug auug   gu  uggggu     agg c
   aua      cu                  g          a          cag   aaaua     aaaguau    uu     u    uag  gg      acuaa   c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr7: 35647909-35648121 [+]
intergenic
Database links

Mature sequence mtr-miR2590j

Accession MIMAT0021334
Sequence

16 - 

agaaugacauggcagaauaaucac

 - 39

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21571671 "Stars and symbiosis: microRNA- and microRNA*-mediated transcript cleavage involved in arbuscular mycorrhizal symbiosis" Devers EA, Branscheid A, May P, Krajinski F Plant Physiol. 156:1990-2010(2011).