Stem-loop sequence mtr-MIR2590i

AccessionMI0018436 (change log)
DescriptionMedicago truncatula miR2590i stem-loop
Gene family MIPF0000834; MIR2590
Literature search

1 open access papers mention mtr-MIR2590i
(1 sentences)

Stem-loop
   uc       u  c             c g          c          ---   ---aga   -ag        uu  ugu  acca    aau    g  ugg  g aa 
5'   aagaaaa uu aagaaugacaugg a aauaaucacc uuagauuuua   uca      aau   ucaugaaa  aa   ua    auaa   cuca cc   cc a  a
     ||||||| || ||||||||||||| | |||||||||| ||||||||||   |||      |||   ||||||||  ||   ||    ||||   |||| ||   || |   
3'   uucuuuu aa uucuuacuguacc u uuauuagugg aaucuaaagu   agu      uua   aguauuuu  uu   au    uauu   gggu gg   gg u  u
   ua       u  a             a g          a          cag   aaauaa   gaa        uu  -uu  ---g    -gu    -  -ua  g ac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr8: 29483055-29483266 [-]
intergenic
Database links

Mature sequence mtr-miR2590i

Accession MIMAT0021333
Sequence

15 - 

agaaugacauggcagaauaaucac

 - 38

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21571671 "Stars and symbiosis: microRNA- and microRNA*-mediated transcript cleavage involved in arbuscular mycorrhizal symbiosis" Devers EA, Branscheid A, May P, Krajinski F Plant Physiol. 156:1990-2010(2011).