Stem-loop sequence mtr-MIR2590h

AccessionMI0018435 (change log)
DescriptionMedicago truncatula miR2590h stem-loop
Gene family MIPF0000834; MIR2590
Literature search

1 open access papers mention mtr-MIR2590h
(1 sentences)

Stem-loop
   aaau                c g          c   a      ---   ---aga   -ag        uu  ugu  acca    a    -ca      c  a 
5'     uuuaagaaugacaugg a aauaaucacc uua auuuua   uca      aau   ucaugaaa  aa   ua    auaa aucu   gccuug ug a
       |||||||||||||||| | |||||||||| ||| ||||||   |||      |||   ||||||||  ||   ||    |||| ||||   |||||| || a
3'     aaguucuuacuguacc u uuauuagugg aau uaaagu   agu      uua   aguauuuu  uu   au    uauu uggg   ugggau ac a
   uucu                a g          a   c      cag   aaauaa   gaa        uu  -uu  ---g    g    ugg      -  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr3: 26494187-26494386 [-]
intergenic
Database links

Mature sequence mtr-miR2590h

Accession MIMAT0021332
Sequence

9 - 

agaaugacauggcagaauaaucac

 - 32

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21571671 "Stars and symbiosis: microRNA- and microRNA*-mediated transcript cleavage involved in arbuscular mycorrhizal symbiosis" Devers EA, Branscheid A, May P, Krajinski F Plant Physiol. 156:1990-2010(2011).