Stem-loop sequence mtr-MIR5283

AccessionMI0018430 (change log)
DescriptionMedicago truncatula miR5283 stem-loop
Literature search

1 open access papers mention mtr-MIR5283
(1 sentences)

Stem-loop
   guaucc    gua   gg       -  aa      a  u     uu    uuu 
5'       gugc   ucg  auguauc gg  aguauc ga uauua  uuuu   a
         ||||   |||  ||||||| ||  |||||| || |||||  ||||    
3'       uaug   ggc  uacauag cc  ucauag uu auaau  aaaa   a
   ------    aag   ua       g  cc      g  u     uu    uaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr5: 40353897-40353999 [+]
intergenic
Database links

Mature sequence mtr-miR5283

Accession MIMAT0021327
Sequence

6 - 

cgugcguaucgggauguaucggaa

 - 29

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21571671 "Stars and symbiosis: microRNA- and microRNA*-mediated transcript cleavage involved in arbuscular mycorrhizal symbiosis" Devers EA, Branscheid A, May P, Krajinski F Plant Physiol. 156:1990-2010(2011).