Stem-loop sequence mtr-MIR2590g

AccessionMI0018412 (change log)
DescriptionMedicago truncatula miR2590g stem-loop
Gene family MIPF0000834; MIR2590
Literature search

1 open access papers mention mtr-MIR2590g
(1 sentences)

Stem-loop
   -cuagccggaa   aug    gg g   g    g    uu        
5'            acc   gggu  u ggu uuau uauu  uuuuuuu 
              |||   ||||  | ||| |||| ||||  |||||| a
3'            ugg   ucua  a uca agua auaa  aaaaagu 
   uguguuauuag   aaa    -a g   g    a    uu        
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr3: 36693381-36693473 [+]
intergenic
Database links

Mature sequence mtr-miR2590g

Accession MIMAT0021309
Sequence

60 - 

aaaugagacugaaaucuaaaggug

 - 83

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21571671 "Stars and symbiosis: microRNA- and microRNA*-mediated transcript cleavage involved in arbuscular mycorrhizal symbiosis" Devers EA, Branscheid A, May P, Krajinski F Plant Physiol. 156:1990-2010(2011).