Stem-loop sequence mtr-MIR399r

AccessionMI0018374 (change log)
DescriptionMedicago truncatula miR399r stem-loop
Gene family MIPF0000015; MIR399
Literature search

9 open access papers mention mtr-MIR399r
(22 sentences)

Stem-loop
   --   c   a u      ugac             -    cac   -   uuu 
5'   gug auu c gggcaa    uuuuuuuggcagu aguu   uug auc   c
     ||| ||| | ||||||    ||||||||||||| ||||   ||| |||    
3'   cac uaa g cccguu    gaagaaaccguca ucaa   aac uag   a
   cu   u   c c      --ua             c    aca   g   uag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr8: 24012653-24012754 [+]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR399r
mtr-MIR399kchr8: 24004937-24005030 [-]
mtr-MIR5246chr8: 24009245-24009314 [-]
mtr-MIR399cchr8: 24010865-24010983 [-]
mtr-MIR399rchr8: 24012653-24012754 [+]
mtr-MIR399kchr8: 24176682-24176775 [-]
mtr-MIR5246chr8: 24180980-24181049 [-]
mtr-MIR399cchr8: 24182595-24182713 [-]
Database links

Mature sequence mtr-miR399r

Accession MIMAT0021271
Sequence

72 - 

ugccaaagaagauuugccccg

 - 92

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21571671 "Stars and symbiosis: microRNA- and microRNA*-mediated transcript cleavage involved in arbuscular mycorrhizal symbiosis" Devers EA, Branscheid A, May P, Krajinski F Plant Physiol. 156:1990-2010(2011).