Stem-loop sequence mtr-MIR172c

Accession

MI0018369

Description

Medicago truncatula miR172c stem-loop

Gene family

MIPF0000035; MIR172

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-172_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

The mir-172 microRNA is thought to target mRNAs coding for APETALA2-like transcription factors. It has been verified experimentally in the model plant, Arabidopsis thaliana (mouse-ear cress). The mature sequence is excised from the 3' arm of the hairpin.

Stem-loop

uauuu  a                     a  -ua      u  aa    uuuug        ug   u 
     gc gauguagcaucaucaagauuc ca   ugaaag gc  augg     uuggauuu  auc g
     || ||||||||||||||||||||| ||   |||||| ||  ||||     ||||||||  ||| a
     cg cuacgucguaguaguucuaag gu   guuuuc ug  uacc     aaucuaaa  uag u
aauac  a                     a  caa      -  ga    ucuug        cg   c 

Genome context

• Coordinates (Mt3.0): AC233663: 10169-10307 [+]
• Overlapping transcripts:

  intergenic

Mature sequence mtr-miR172c-5p

• Accession: MIMAT0021265
• Previous IDs: mtr-miR172c*
• Sequence: 12 - guagcaucaucaagauucaca - 32
• Evidence: experimental; Solexa [2]

Mature sequence mtr-miR172c-3p

• Accession: MIMAT0021266
• Previous IDs: mtr-miR172c
• Sequence: 110 - agaaucuugaugaugcugcau - 130
• Evidence: experimental; Solexa [1-3]

References

1. PMID:21571671 "Stars and symbiosis: microRNA- and microRNA*-mediated transcript cleavage involved in arbuscular mycorrhizal symbiosis" Devers EA, Branscheid A, May P, Krajinski F Plant Physiol. 156:1990-2010(2011).
2. PMID:21762498 "Identification of drought-responsive microRNAs in Medicago truncatula by genome-wide high-throughput sequencing" Wang T, Chen L, Zhao M, Tian Q, Zhang WH BMC Genomics. 12:367(2011).
3. PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).