|
miRBase |
|
Stem-loop sequence mtr-MIR172b |
|||||
| Accession | MI0018368 | ||||
| Description | Medicago truncatula miR172b stem-loop | ||||
| Gene family | MIPF0000035; MIR172 | ||||
| Community annotation |
This text is a summary paragraph taken from the Wikipedia entry entitled mir-172_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ... The mir-172 microRNA is thought to target mRNAs coding for APETALA2-like transcription factors. It has been verified experimentally in the model plant, Arabidopsis thaliana (mouse-ear cress). The mature sequence is excised from the 3' arm of the hairpin. |
||||
| Stem-loop |
uguuu a auaugugaaugaugcagaguggaacug
gc gauguagcaucaucaagauuc c
|| |||||||||||||||||||||
cg cuacgucguaguaguucuaag u
uauac a aauaaaguuuucuaguuaacuuuauaa
|
||||
| Genome context |
|
||||
Mature sequence mtr-miR172b |
|
| Accession | MIMAT0021264 |
| Sequence |
85 - agaaucuugaugaugcugcau - 105 |
| Evidence | experimental; Solexa [1-3] |
References |
|
| 1 |
PMID:21571671
"Stars and symbiosis: microRNA- and microRNA*-mediated transcript cleavage involved in arbuscular mycorrhizal symbiosis"
Plant Physiol. 156:1990-2010(2011).
|
| 2 |
PMID:21762498
"Identification of drought-responsive microRNAs in Medicago truncatula by genome-wide high-throughput sequencing"
BMC Genomics. 12:367(2011).
|
| 3 |
PMID:22156213
"MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs"
Genes Dev. 25:2540-2553(2011).
|