|
miRBase |
|
Stem-loop sequence mtr-MIR5250 |
|||||
| Accession | MI0018351 | ||||
| Description | Medicago truncatula miR5250 stem-loop | ||||
| Stem-loop |
uc - a c uc g u u u uu uug aagc gg ucu aucuaacauucu gaacacuuu aaucuc aaau gu a ||| |||| || ||| |||||||||||| ||||||||| |||||| |||| || a aac uucg cc agg uagauuguaaga uuuguggaa uuggag uuua cg a uu a a a ca g u - - uu |
||||
| Genome context |
|
||||
Mature sequence mtr-miR5250 |
|
| Accession | MIMAT0021246 |
| Sequence |
84 - ugagaauguuagauacggaac - 104 |
| Evidence | experimental; Solexa [1-2] |
References |
|
| 1 |
PMID:21571671
"Stars and symbiosis: microRNA- and microRNA*-mediated transcript cleavage involved in arbuscular mycorrhizal symbiosis"
Plant Physiol. 156:1990-2010(2011).
|
| 2 |
PMID:22156213
"MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs"
Genes Dev. 25:2540-2553(2011).
|