Stem-loop sequence mtr-MIR5241c

AccessionMI0018342 (change log)
DescriptionMedicago truncatula miR5241c stem-loop
Gene family MIPF0001290; MIR5241
Literature search

1 open access papers mention mtr-MIR5241c
(1 sentences)

Stem-loop
   -----     gcuaa       cca  ag     aa   -au  g    au   ug  ug    u 
5'      guuau     uggucuu   cu  caauu  agu   ug gcuc  uuu  uu  gucg a
        |||||     |||||||   ||  |||||  |||   || ||||  |||  ||  |||| a
3'      caaua     accggaa   ga  guuag  ucg   ac ugag  aag  aa  cagu u
   uguag     ----g       --a  ga     -a   guu  g    --   gu  gu    g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr6: 21075679-21075796 [-]
intergenic
Database links

Mature sequence mtr-miR5241c

Accession MIMAT0021237
Sequence

64 - 

ugacugaauggaagagugcau

 - 84

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21571671 "Stars and symbiosis: microRNA- and microRNA*-mediated transcript cleavage involved in arbuscular mycorrhizal symbiosis" Devers EA, Branscheid A, May P, Krajinski F Plant Physiol. 156:1990-2010(2011).